[Maximum number: 5]

Tobacco smoke contains a number of mutagens that are known to induce lung tumours in rodents, including NNK, a nitrosamine. The graph shows the relationship between NNK and lung tumour incidence in male rats. NNK was administered by subcutaneous injection for 20 weeks. Data points on the graph show percentage incidence of lung cancer in treatment groups of between 20 and 80 rats.

Graph removed for copyright reasons

(a)

Explain the effects of mutagens such as NNK.

[ 2 ]

(b)

Evaluate the hypothesis that nicotine is not a mutagen.

[ 3 ]

[Maximum number: 1]

The genetic code is shown.

In a coding gene, the DNA triplet in the transcribed strand is changed from AGG to TCG. What would be the result of this change in the genome?

A non-functional protein

A different but functional protein

No change in the protein

Termination of the polypeptide

[Maximum number: 1]

A mutation in which type of cell could be inherited?

Beta cell in the pancreas

T-cell in the lymph

Sperm cell in the testis

Skeletal muscle cell in the diaphragm

[Maximum number: 2]

Psammonobiotus balticus belongs to a group of protists (unicellular eukaryotic organisms) that have a shell surrounding most of the cell, which provides shelter from predators. The graph shows the frequency of varying shell lengths in a population of P. balticus.

(a)

Mutations may increase variation within a species. Compare and contrast substitution and insertion mutations.

[ 2 ]

[Maximum number: 1]

The effect of substitution mutations in a salamander gene was studied. Some mutations have no observable effect on the phenotype and are called silent mutations.
What conclusion about the position of the mutation in the codon can be drawn from this graph?

Most changes in this gene are silent.

A change in any position of the codon will always cause a change in the protein.

More phenotype changes occur due to a mutation in the second position.

There is a 50 % chance that a change in the third position will not affect the phenotype.

[Maximum number: 1]

What is a feature of mutations?

They occur randomly.

They only occur in germ cells.

The frequency cannot be increased by external factors.

They only occur in certain base sequences of the genome.

[Maximum number: 1]

What change causes sickle cell anemia?

One amino acid less in a polypeptide of hemoglobin

A mutation leading to an extra codon in the genome

Thymine replacing adenine in DNA

Failure of tRNA to correctly transcribe the sequence of codons from mRNA

[Maximum number: 1]

A base substitution in a gene has changed a codon. Which of these consequences could result from a base substitution in a codon?
I. Another amino acid will be incorporated in the protein
II. A stop codon is generated
III. The same protein will be synthesized

I only

I and II only

I and III only

I, II and III

[Maximum number: 1]

Knockout organisms are used as models in research. The p53 knockout mouse is named after p53, a gene which codes for a protein that normally suppresses the growth of cancerous tumours.

How could scientists use p53 knockout mice in cancer research?

To extract tumour suppressor protein from p53 knockout mice for cancer treatments

To obtain functional copies of the p53 gene to use in gene replacement therapy

To investigate the effect of new anti-cancer drugs on mouse tumours

To study the effect of mutations on the expression of the p53 gene

[Maximum number: 1]

Two DNA sequences are shown.
Sequence 1 CACGTGGACTGAGGACTCCTC \\ Sequence 2 CACGTGGACTGAGGACACCTC
What type of mutation is occurring between sequence 1 and sequence 2 ?

Substitution

Polyploidy

Insertion

Deletion