IB Biology

A Unity and Diversity

A1.1 Water

A1.2 Nucleic acids

A2.1 Origins of cells

A2.2 Cell structure

A2.3 Viruses [HL only]

A3.1 Diversity of organisms

A3.2 Classification and cladistics [HL only]

A4.1 Evolution and speciation

A4.2 Conservation of biodiversity

B Form and Function

B1.1 Carbohydrates and lipids

B1.2 Proteins

B2.1 Membranes and membrane transport

B2.2 Organelles and compartmentalization

B2.3 Cell specialization

B3.1 Gas exchange

B3.2 Transport

B3.3 Muscle and motility [HL only]

B4.1 Adaptation to environment

B4.2 Ecological niches

C Interaction and Interdependence

C1.1 Enzymes and metabolism

C1.2 Cell respiration

C1.3 Photosynthesis

C2.1 Chemical signalling [HL only]

C2.2 Neural signalling

C3.1 Integration of body systems

C3.2 Defence against disease

C4.1 Populations and communities

C4.2 Transfers of energy and matter

D Continuity and Change

D1.1 DNA replication

D1.2 Protein synthesis

D1.3 Mutation and gene editing

D2.1 Cell and nuclear division

D2.2 Gene expression [HL only]

D2.3 Water potential

D3.1 Reproduction

D3.2 Inheritance

D3.3 Homeostasis

D4.1 Natural selection

D4.2 Stability and change

D4.3 Climate change

Question rangeD1.2.8—Genetic code features

[Maximum number: 1]

The table shows information on the genetic code of four different mRNA sequences. Which sequence demonstrates degeneracy in the genetic code?

mRNA sequence

Amino acids

UUU UUA UCU

Phe Leu Ser

CUU CCU CUU

Leu Pro Leu

AUG ACG AAG

Met Thr Lys

GUU GGU GUG

Val Gly Val

[Maximum number: 8]

A short base sequence of mRNA and a table of the genetic code are shown below.
Sequence of mRNA
AUGAGCCGAAGGUAGCUG
Table of the genetic code

(a)

Outline the function of codons.

[ 1 ]

(b)

(i)

Determine the sequence of amino acids that could be translated from the sequence of mRNA.

[ 1 ]

(ii)

Determine the DNA base sequence transcribed to form this sequence of mRNA.

[ 1 ]

(c)

Suggest a hypothesis that accounts for the slightly different meaning of some codons in a very limited number of organisms.

[ 1 ]

(d)

The diagram shows a section of a polypeptide.

[ 2 ]

(i)

Annotate the diagram to show a peptide bond between two amino acids.

[ 1 ]

(ii)

State the type of reaction that removes water while linking amino acids together to form polypeptides.

[ 1 ]

(e)

Outline the function of Rubisco and of spider silk in relation to their three-dimensional conformation.

[ 2 ]

[Maximum number: 1]

Which of the following is a consequence of the degeneracy of the genetic code?

Codons affected by mutagens always code for non-functional proteins.

There are variations in the amino acid sequences for the same protein.

Some base mutations cause no changes in protein structure.

A codon may code for more than one amino acid in response to environmental changes.

[Maximum number: 1]

How is the information in the genetic code used?

To predict the genotype of gametes

To distinguish prokaryotic genomes from eukaryotic genomes

To deduce phenotypes in pedigree charts

To translate mRNA into polypeptides

[Maximum number: 1]

What is the minimum number of nucleotides needed to code for a polypeptide composed of 210 amino acids?

210

420

630

[Maximum number: 1]

The diagram shows the structure of a peptide.

How many bases would be present in the length of an mRNA molecule coding for this peptide?

[Maximum number: 1]

The table shows information on the genetic code of four different mRNA sequences. Which sequence demonstrates degeneracy in the genetic code?

mRNA sequence

Amino acids

UUU UUA UCU

Phe Leu Ser

CUU CCU CUU

Leu Pro Leu

AUG ACG AAG

Met Thr Lys

GUU GGU GUG

Val Gly Val

(a)

Describe the genetic code and its relationship to polypeptides and proteins.

[ 5 ]

(b)

Outline the role of proteins in active and passive transport of molecules through membranes.

[ 5 ]

(c)

Many cell functions, like synthesis of macromolecules and transport, require energy in the form of ATP. Explain how ATP is generated in animal cells.

[ 8 ]

[Maximum number: 2]

A sequence of DNA is translated in a continuous reading frame without spaces. Each triplet of nucleotides corresponds to successive amino acids in a polypeptide. The sequence given shows part of one strand of a DNA molecule.
AATGCGAGGATGCCCAAGCTGAATAGCGTAGAGGGGTTTTCATCATTTGAGGACGATGTAT

(a)

Identify the first triplets of each possible reading frame for this piece of DNA.

[ 1 ]

(b)

Define what is meant by an open reading frame.

[ 1 ]

[Maximum number: 6]

A section of mRNA contains the start codon for translation of a polypeptide by the ribosomes.

(a)

Identify the nucleotides of the start codon for the polypeptide.

[ 1 ]

(b)

State the chemical difference between the $5^{\prime}$ end and the $3^{\prime}$ end of a DNA strand.

[ 1 ]

(c)

Within the base sequence shown in the diagram, the sequence for the stop codon UGA appears. Explain the reasons for translation continuing beyond this point in the mRNA.

[ 2 ]

(d)

Describe how bioinformatics can help identify genes within the DNA of an organism.

[ 2 ]